Home Accessibility Courses Twitter The Mouth Facebook Resources Site Map About Us Contact
 
20.9.2014 - We have just updated our course layouts and descriptions and added our 2015 schedule.

Data for sample bioinformatics program in Perl
Data Munging example from a Well House Consultants training course
More on Data Munging [link]

This example is described in the following article(s):
   • Converting codons via Amino Acids to Proteins in Perl - [link]

This example references the following resources:
http://www.ncbi.nlm.nih.gov/nuccore/384551662?report=fasta

Source code: cdk.fasta Module: P669
# Homo sapiens cyclin-dependent kinase 5, regulatory subunit 2 (p39) (CDK5R2), mRNA
# from http://www.ncbi.nlm.nih.gov/nuccore/384551662?report=fasta

GGGTGGGGCTGACGCTGCAGCTGGCGCAGCTCAGGATTAGAGCAGCGGAGCCGCCTAGCAGCCACCTTCC
CCCGCCAGTCCGCGCGCCCGGGCCGGGGCTAGGCCCCCCACCGCCGGGTCCCCCGGGGCTGCAGTAGCAG
CGGCGCCGCCCGCGGCTCCCGCTGGGGCCTGGGCGCCGGCCCCGCTCTGCAGGATGGGCACAGTGCTGTC
TCTTTCGCCTGCCTCCTCGGCCAAGGGCCGGAGGCCCGGCGGGCTGCCCGAGGAGAAGAAGAAGGCGCCG
CCCGCGGGGGACGAGGCGCTGGGGGGCTACGGGGCGCCGCCAGTGGGCAAGGGCGGCAAAGGCGAGAGCC
GACTCAAGCGGCCGTCCGTGCTCATCTCGGCGCTCACCTGGAAGCGCCTGGTGGCCGCGTCCGCCAAGAA
GAAGAAAGGCAGCAAGAAGGTGACACCCAAGCCGGCATCCACGGGCCCCGACCCCCTGGTCCAGCAACGC
AACCGCGAGAACCTTCTCCGCAAGGGCCGGGATCCCCCCGACGGCGGCGGCACCGCCAAGCCCCTGGCGG
TGCCAGTGCCCACCGTGCCCGCGGCTGCCGCCACCTGCGAGCCACCGTCGGGGGGCAGCGCGGCCGCTCA
GCCGCCGGGCTCGGGCGGGGGAAAGCCTCCGCCGCCGCCTCCCCCAGCCCCGCAGGTGGCGCCGCCGGTG
CCTGGCGGCTCGCCGCGGCGGGTCATCGTGCAGGCGTCCACCGGCGAGCTGCTGCGCTGTCTGGGCGACT
TCGTGTGCCGACGCTGCTATCGCCTCAAGGAGCTGAGCCCGGGCGAGCTGGTGGGCTGGTTCCGCGGTGT
GGACCGCTCGCTGCTGCTGCAGGGCTGGCAAGACCAGGCCTTCATTACGCCTGCAAACCTGGTGTTCGTG
TACCTGCTGTGCCGCGAGTCGCTGCGTGGGGACGAGCTGGCGTCGGCCGCCGAGCTGCAGGCCGCCTTCC
TCACCTGCCTCTACCTCGCCTACTCCTACATGGGCAACGAGATCTCCTACCCACTCAAGCCCTTCCTCGT
GGAGCCCGACAAGGAGCGCTTCTGGCAGCGCTGCCTGCGCCTCATCCAGCGGCTCAGCCCGCAGATGCTG
CGGCTCAACGCCGACCCCCACTTCTTCACGCAGGTCTTTCAAGACCTCAAGAACGAGGGCGAGGCCGCCG
CCAGCGGCGGGGGCCCACCGAGCGGGGGCGCGCCCGCCGCCTCCTCGGCCGCCAGGGACAGCTGCGCGGC
CGGAACCAAGCACTGGACTATGAACCTGGACCGCTAGGGATACCCAGGGGCCGCGCCCATCCCCCGCCCC
AGCCCCTGACACACACTCGGACCCCCCGGGACCACAAAGCCACCGCCGCTGTTACCGCCGCTCAGCGCCC
CGGCTGGGCGGAGGAGGAGACGCCCATGCCCCTCAGGGGAAAGTGGAGACCGGGACACCAGAGGCCGCGG
TGTTTGGATTTGCTGGGCGTGGAGTGGGGACGGAAGATGAGCGCGGGAAAGGCACTCCAACCTCACTCTT
CCCGTCTGTCTGCGCCCCCATTTCTCCATTTCTGCCGGGGTCTCCCCCTTCCCTTCAGCCCATTCCCCCT
CGGTTTTATCCATTTCCTTGCCTCCTTTTTGTGTCTTCATTTTTCCTCCTGTCTGCATTCCTCTCTCTCT
CTCTCCCTCTCTCTCCTGTTCCTCTCTTTCTTCCTCCCTCTCCCTGCCTTTCCATTTTCCGTTCCTTGGG
TTTGTGTGTCTGCATCTCCATCTTACCCCTTGCCTGACTGTACCCCGTAGACCCCTGTTTCTCCTCCTGC
ACCTGTGTCCCCATCTGCCCTTCTTGTTGCTCCTGTCATGTGTCACCATCTTCCCTCCTGTCTGCCTTCT
TCCTCCACTTGTGTCAGCTTGCATTTTTTTATTCCTGACTGAGTCACCACACCCCTCTCCCCTGATCAAA
GGGAATATTAGTTTTTAATTTGGATCGACTGAGGTGCCAGGAGAAACTGCAGTCCCAGGTATCCAGACAG
CCACCAGGATGGTCCCTCGCCCCACCCCCACCGCCTCTCCCCACCTTTTCCAACGTGTTGCATGCTGGGA
GCTGGGGGGTGTGGGGGAAGGGGCTGCCGGCTTCTTTCAGGAGGCTGAGGTTTGGAGGCAAAATCAACCT
GGGAGACCACCCCGGCCGCGGCGCCTCAGTGGACAGGTGGGAGGAAAAGAAAACTTCTTACCTTGGAGGA
GGGACATCCCGCTTCCTTATCCTTAGCTTTTTTGTTGCTCCTCCCCACTGCCCCTTTTAATTTATTTGGT
TGTTTGCGGAGGGAGGGGGGAGGGGGGTAGGCTGGGCCGGGAACTGTCCGAGGTGCTGAGCTGGGGCGGG
ACCGGAATCCTCCCGGTAGGGTACCAGGGACTGAGTTGGGCCTGGGGCCGTGTCCAAGGTGCCAATGATG
CGGGCCGACAGAGCGGGCCGCACTGTCTGTCTGTCCGTCTGTCCCGGAAAGAACTATAAAGCGCTGGAAG
CGCCTGCA
Learn about this subject
This module and example are covered on our public Perl for Larger Projects course. If you have a group of three or more trainees who need to learn the subject, we can also arrange a private or on site course for you.

Books covering this topic
Yes. We have over 700 books in our library. Books covering Perl are listed here and when you've selected a relevant book we'll link you on to Amazon to order.

Other Examples
This example comes from our "Data Munging" training module. You'll find a description of the topic and some other closely related examples on the "Data Munging" module index page.

Full description of the source code
You can learn more about this example on the training courses listed on this page, on which you'll be given a full set of training notes.

Many other training modules are available for download (for limited use) from our download centre or under an Open Training Notes License from our sister site http://www.training-notes.co.uk.

Other resources
• Our Solutions centre provides a number of longer technical articles.
• Our Opentalk forum archive provides a question and answer centre.
The Horse's mouth provides a daily tip or thought.
• Further resources are available via the resources centre.
• All of these resources can be searched through through our search engine
• And there's a global index here.

Web site author
This web site is written and maintained by Well House Consultants.

Purpose of this website
This is a sample program, class demonstration or answer from a training course. It's main purpose is to provide an after-course service to customers who have attended our public private or on site courses, but the examples are made generally available under conditions described below.

Conditions of use
Past attendees on our training courses are welcome to use individual examples in the course of their programming, but must check the examples they use to ensure that they are suitable for their job. Remember that some of our examples show you how not to do things - check in your notes. Well House Consultants take no responsibility for the suitability of these example programs to customer's needs.

This program is copyright Well House Consultants Ltd. You are forbidden from using it for running your own training courses without our prior written permission. See our page on courseware provision for more details.

Any of our images within this code may NOT be reused on a public URL without our prior permission. For Bona Fide personal use, we will often grant you permission provided that you provide a link back. Commercial use on a website will incur a license fee for each image used - details on request.

You can Add a comment or ranking to this page

© WELL HOUSE CONSULTANTS LTD., 2014: Well House Manor • 48 Spa Road • Melksham, Wiltshire • United Kingdom • SN12 7NY
PH: 01144 1225 708225 • FAX: 01144 1225 899360 • EMAIL: info@wellho.net • WEB: http://www.wellho.net • SKYPE: wellho

PAGE: http://www.wellho.net/resources/ex.php4 • PAGE BUILT: Thu Sep 18 11:03:17 2014 • BUILD SYSTEM: WomanWithCat